KvngDon5771 KvngDon5771

22-02-2024
Social Studies

contestada

Jesus states in Matthew 18: 15-16 that when we have an issue with a person we are to ________.
1) Confront the person privately
2) Gossip about the person to others
3) Ignore the issue and hope it goes away
4) Seek revenge against the person

Respuesta :

Otras preguntas

Suppose scientists found parts of the DNA from a dinosaur. What info would this discovery provide? What info would it not give them?

1/3 x 1/5 in the simplest form

On the map, the grocery store is 2 inches away from the library. The actual distance is 1.5 miles. The same map shows that the movie theater is 20 inches from t

1) A fashion designer makes and sells hats. The material for each hat costs $5.50. The hats sell for $12.50 each. The designer spends $1400 on advertising. How

why is the work output always less than the work input?

Can you pleas help me solve this assignment?

How many times dose 63 go into 359

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

if an element has more than one ionic change how is that piece of information represented in the chemical name

What to numbers can be added up the six multiplied to nine