dabi
dabi
21-08-2018
Mathematics
contestada
the width of a rectangle is 15 and the perimeter is 72
Respuesta :
MrCreepyPlayz
MrCreepyPlayz
21-08-2018
You didn’t really explain it very well but I’m assuming you need to find the rest of the sides. I have done the work on paper. This might help. Ask me if you have any questions.
Answer Link
VER TODAS LAS RESPUESTAS ( 33+ )
Otras preguntas
What do they mean when they say, "Society pays for the end results of alcohol abuse"? Do they mean that the person who consumed it pays the consequences or lite
what stress force on a reverse fault?
Which viruse reproduces & what reproductive cell ?
George tells you that when variables are in the denominator, the equation four over five plus three over x equals one over two becomes unsolvable. George explai
Marley has read 112.5 pages of a book. By the end of today, she plans to have read at least a total of 360 pages. If she reads 45 pages per hour, what is the mi
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Derek is deciding what to wear to school. He has a green shirt, a purple shirt, and a red shirt, and he has beige, gray, and blue pants. He also has sandals, ru
Color ___ indicates that one color is dominating a picture.
Suppose a pizza must fit into a box with a base that is 12 inches wide. You can use the quadratic function a=(Pi)r^2 to find the area of a pizza in terms of its
Sarabeth ran 1 2/5 miles on a path around the park. This was 5/8 of the distance around the park. What is the distance around the park.
