madalsz341 madalsz341

25-10-2018
Mathematics

contestada

Mr. Thomas' car can travel 17.6 miles per gallon of gas. If his gas tank holds 11 gallons, how far can he travel on a full tank of gas?

Respuesta :

Аноним Аноним

25-10-2018

Answer is in the picture in this post.

Ver imagen Аноним

Answer Link

Otras preguntas

Pencils can be purchased in packages of 12 or 25. If Karl purchased 8 packages to get 135 pencils, how many packages of 12 did he buy?

The preganglionic fibers of the sympathetic nervous division originate in segments ____ of the spinal cord and first enter the ____ ganglia.

help help help help

A rental car company charges $35 per day to rent a car and $0.15 for every mile driven. Enola wants to rent a car, knowing that: She plans to drive 450 miles. S

Match the cultural belief to the correct religion Buddhism, Judaism, Islam,Christian Science,Confucianism

Hemp bell bell help math

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

developed first accurate map of land and water?

On a coordinate plane titled area of maya's poster, a curved line with a minimum value of (1, negative 1) crosses the x-axis at (0, 0) and (2, 0), and the y-axi

Find the similarities or interesting facts about system of modern phones and human brain.