yahyeetmemes yahyeetmemes

23-01-2019
Geography

contestada

Circle the letter of the sentence that describes how a fault-block mountain is created.

A. It is created by two normal faults
B. It is created by two reverse faults
C. It is created by a strike-slip fault
D. It is created by shearing

Respuesta :

spatterson0701 spatterson0701

23-01-2019

answer is c is the answer

Answer Link

Otras preguntas

Where does the water in streams and rivers originate? a. precipitation b. runoff c. ice and snowpacks d. all of the above

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Instructions:Select the correct answer. Read the following excerpt from the poem “On Imagination” by Phillis Wheatley .Imagination! who can sing thy force?Or w

What role does the media play in reporting human rights violations in the right manner

In a parking lot there are motorcycles and cars. You count 98 wheels, and your friend counts 30 vehicles. How many cares are there? How many motorcycles? Assign

What do they mean when they say, "Society pays for the end results of alcohol abuse"? Do they mean that the person who consumed it pays the consequences or lite

. If a human has not eaten in 6 days,

Who discovered polio vaccine

Describe two ways in which bacteria and the fungus Penicillium are similar? Describe two ways in which bacteria and the fungus Penicillium are different?

Becca had 13/15 of a yard of ribbon to use for her crafts projects. She used 3/7 of a yard to make a bow. How much ribbon, r, does Becca have left? Set up an e