julio007 julio007
  • 24-01-2020
  • English
contestada

is an implied or indirect reference found in literature,
A theme
A point of view
An allusion

Respuesta :

taestea991
taestea991 taestea991
  • 24-01-2020
An allusion. The basic definition is on google if you need to fact check this! (:
Answer Link
Tarainusa Tarainusa
  • 07-05-2020

Answer:

An allusion

Explanation:

Answer Link

Otras preguntas

In hexagonal writing and analysis of literary devices explores
In hexagonal writing and analysis of literary devices explores
What is the color of the stars with the lowest surface temperature
A common way to deliver anesthesia for surgery and childbirth is to inject the anesthetic agent into the epidural space. A possible complication of this procedu
how to get the answer to this equation 1+4=5 2+5=12 3+6=21 8+11=?
What educational level, age and econimic status of the audience do I reach when talking bout geriatric offices
1. Obligate anaerobes are often grown in an anaerobe jar, which completely excludes oxygen from the environment. How is the environment within a tube of fluid t
What the the equation -984-n=-285 what does n equal
help answer ASAPPP 10 points
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC