Meowtwo2996 Meowtwo2996

26-02-2020
Biology

contestada

Write the base sequence of the complementary strand of double-helical DNA in which one strand has the sequence (5)ATGCGTAGCCTAGCCTAGTAGCCTTC(3). What is RNA sequence copied from this sequence?

Respuesta :

omololaj501 omololaj501

26-02-2020

Answer:

Explanation:

In the DNA, the nitrogen bases, Adenine A (a purine) forms double bond with Thymine T (a pyrimidine) but in RNA, the bond is with Uracil U (a pyrimidine) instead of Thymine; Guanine G (a purine) forms triple bond with Cytosine C (a pyrimidine): this also occur in RNA. This we have:

DNA sequence: 5' ATGCGTAGCCTAGCCTAGTAGCCTTC 3'

Complimentary strand : 3' TACGCATCGGATCGGATCATCGGAAG 5'

The RNA sequence is produced running from the 5' to the 3' direction thus, the complimentary strange will be used.

5'AUGCGUAGCCUAGCCUAGUAGCCUUC 3'

Answer Link

Otras preguntas

Are all atoms (elements) neutral? And if not, how is the amount of electrons discovered?

Who had the most political power under the articles of confederation?

what are the challenges of icarus

Name the property used to make the conclusion. If x=y and y=4, then x=4.

Which phrase helps you identify connections between ideas? A) My main point B) It is essential C) As a result D) Most important

Which of the following statements best describes the results of improvements in computer technology since 1950? Computers have become smaller and more efficient

what is the purpose of the written conclusion in an experiment?

which one of the following sentences contains a predicate adjective? A. I bought my lunch for the first tim this year. B. The teacher appeared angry when Dave

In "The Parable of the Good Samaritan," what does the priest do? a. He ignores the man who needs his help. b. He treats the Samaritan with warmth and kindness.

PLEASE HELP Identify the sentence that uses correct punctuation. a. We had to walk, all the way to the train station, the bus doesn't go that far. b. We had to