alanabrissett alanabrissett

23-04-2020
French

contestada

translate to french: at what time do you get up?

Respuesta :

Аноним Аноним

23-04-2020

Answer:

à quelle heure vous levez-vous?

Explanation:

Hope this helps :)

Answer Link

Otras preguntas

age is just a number when it comes to a relationship

Codons Which amino acids does this mRNA strand code for? *You must spell out the entire name of the amino acid* 5'CCGGAUGUCCGUAUAACGGC3'

Write sentences where all the words begin with the same letter as the word taste, recipe and diet

One tip for success with an ERP implementation is to have the project _______. 1) managed by an independent contractor 2) managed by a full-time executive 3) ro

What is the measure of angle(-3,4)(1,4)(1,8) in degrees

2 3 4 What were the goals behind the creation of the League of Nations? Check all that apply. Oto foster international cooperation Oto foster control of trade m

Torque (T) can be determined by measuring the angular deflection (theta, in radians) of a hollow cylinder. It is necessary to study the effect produced by cutti

can people have an allergic reaction by cross-contact when the protein of an allergy-causing food comes in contact with another food?

What is the purpose of amendments to the Constitution? a. Gives Congress the ability to get rid of laws they don't like b. Allows the Constitution to change wit

Give the ratio of trigonometric sink