Bity123 Bity123

23-07-2020
Spanish

contestada

Jaime llamó a Ricardo por teléfono. Answer Prompts: Ricardo/teléfono Word bank is quién qué dónde cuándo por qué cómo cuál

Respuesta :

knowmore2345 knowmore2345

24-07-2020

Answer:

Ricardo is quien

Telefono is que

Explanation:

Quien is who and que is what

Ricardo is who is talking and the phone is what he is using to talk

Answer Link

cjewel759 cjewel759

10-01-2021

Answer:

¿Quién llamó a Ricardo por teléfono?

Explanation:

This is the correct answer for plato and edmentum users

Answer Link

Otras preguntas

1.Why is the coding sequence (whether DNA or RNA) at least three times as long as the protein sequence it codes for? 2.How can the DNA sequence be so different

help answer ASAPPP 10 points

Jonathan has a collection of 400 marbles. Blue marbles make up 17%, percent of his collection. How many blue marbles does Jonathan have?

Which best explains how the structure of the office of the president helps fulfill the office’s role? A The office is led by the chief of staff, who serves as a

What event takes place in the second entry of Anne Frank's dairy?

HELP ASAP!!!Why does Ralph become the leader of the group at the beginning of the novel? A. because Ralph is manipulative and p

how to solve these questions?

Becca had 13/15 of a yard of ribbon to use for her crafts projects. She used 3/7 of a yard to make a bow. How much ribbon, r, does Becca have left? Set up an e

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

how to solve these questions?