Martha is a 40 percent partner in the MMM Partnership, with an outside basis of $50,000. MMM distributes $40,000 cash and accrual-basis accounts receivable with a basis and fair market value of $20,000. Martha does not recognize gain or loss on the distribution and takes a basis in the cash of $40,000 and a basis in the receivables of $10,000.
a) true
b) false

Question

ljdm7304 ljdm7304

24-07-2020
Business

contestada

Martha is a 40 percent partner in the MMM Partnership, with an outside basis of $50,000. MMM distributes $40,000 cash and accrual-basis accounts receivable with a basis and fair market value of $20,000. Martha does not recognize gain or loss on the distribution and takes a basis in the cash of $40,000 and a basis in the receivables of $10,000.
a) true
b) false

Respuesta :

Otras preguntas

Please show your work: Select ALL the transformations that occur to the parent function f(x) to form g(x)=0.8f(x−2)−8

Is the High Valyrian language unofficial/unreal?

Use the formula to solve the problem. Area of a trapezoid = (1/2)(a + b)h, where a and b are the lengths of the two parallel sides and h is the altitude. The ar

Read the paage. Excerpt from Queen of the Fall by Chri Van Allburg Three day later, Annie called on the barrel maker again and convinced him that he wa not craz

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

a company wants to encrypt a document containing important passwords. to do this, the sum of two positive numbers will need to be minimized. if the product of b

When an object of ma m1 i hung on a vertical pring and et into vertical imple harmonic motion, it ocillate at a frequency of 12. 0 Hz. When another object of ma

control c will print (in the command window) a list of the variables and arrays in the current workspace.group of answer choicestruefalse

This is a variable whose content is read only and cannot be changed during the program's execution

When a school has a faculty with varying levels of technology adoption and knowledge, what can they do within the school to help support others with using onlin

abiolataiwo2015 abiolataiwo2015 · Answer 1 · 2020-07-27T14:27:03+02:00

Answer:

True

Explanation:

Based on the information given we were told that Martha does not recognize gain or loss on the distribution and takes a:

Basis in the cash of $40,000 which is TRUE because we were told that MMM distributes $40,000 cash to Martha

Basis in the receivables of $10,000 which is TRUE because we were told that she has an outside basis of $50,000 with distributed cash of $40,000 and accrual-basis accounts receivable of $20,000. Therefore the basis in the receivable of $10,000 is calculated as:

Cash $40,000 + Account receivable $20,000=$60,000

Hence,

$60,000- Outside basis $50,000

=$10,000 Basis in the receivable