xokara43 xokara43

21-10-2020
Mathematics

contestada

help plz I will give you brainiest if its correct :)

help plz I will give you brainiest if its correct class=

Respuesta :

22-10-2020

Answer:

The first one

Step-by-step explanation:

Answer Link

22-10-2020

it is a, the first one

Answer Link

Otras preguntas

100 Points! Geometry question. Photo attached. Please show as much work as possible. Thank you!

Let a be the distance between the points (1,1,3) and (3,0,1) plus the norm of the vector (3, 0, -4).

En la calabaza de verano, el color blanco del fruto (A) es dominante sobre el color amarillo (a). El fruto en forma de disco (B) es dominante sobre la fruta esf

Drag each label to the correct location on the image. Here's one way to follow the scientific method. Place the missing steps in the correct position in the pro

They closed up their suits and lumbered across the staging area to a large air-lock door. This was a supply air lock. It did not lead into the hot zone. It led

In the year 1980, the population of Merrick was modeled by the function P= f(t) = 1.4(1.0052)', where P is in millions of people and t is in years since 1980. U

Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A:

11. Two similar solids are shown below. A Solid A has a height of 5 cm. Solid B has a height of 7 cm. 5 cm 12 B Diagrams not drawn to scale 7 cm Mari claims tha

the risk that a company will not be able to meet its obligations when they become due is an aspect of: a)business risk. b)inherent risk. c)information risk. d)r

According to molecular orbital theory the highest energy molecular orbital that is occupied with electron is referred to as ____ a. degenerate. b. antibonding.