kelsyg12306 kelsyg12306

25-10-2020
Mathematics

contestada

Cindy looks around at an assembly. She notices her younger sister to her right and her older brother 24
meters ahead of her. If Cindy's brother and sister are 26 meters apart, how far apart are Cindy and her
younger sister?

Respuesta :

lolimkyla lolimkyla

25-10-2020

Assuming this is Pythagorean Theorom stuff

I got 10m

24^2 + 10^2 = 26^2

Answer Link

Otras preguntas

Which of the following assist in the recall of information? a. A synonym b. Structural changes c. Mnemonic devices d. Trivial skills

7. Provide an example of how hatural selection can create new species:

What is the information ratio of a portfolio, given the following ordered monthly returns (in percent) of a portfolio (p) and the appropriate benchmark (b)? rp:

What teaching strategies would you use to prevent challenging behavior? ( Teaching strategies, not behavior management strategies.) List three specific strategi

Codons Which amino acids does this mRNA strand code for? *You must spell out the entire name of the amino acid* 5'CCGGAUGUCCGUAUAACGGC3'

We have witnessed outsourcing of most manufacturing jobs from USA to China, along with IT service jobs to India. Then more recently, IMF has said that AI will a

Is the given number a possible solution to the inequality?

Sketch the straight line defined by the linear equation by finding the x- and y-intercepts. 2x + 3y − 21 = 0

What is the purpose of Kelley’s rhetorical questions underlined on pages 3 and 4

The CPU scheduler decides _____ the processes ( and their threads ) access the ____________. The scheduler concerns the scheduling of both __________ and ______