jade8822 jade8822

22-01-2021
Social Studies

contestada

Ancient nomadic tribes expressed themselves through and . A. prayer . . . song B. art . . . sculpture C. poems . . . fables D. hunting . . . sacrifices

Respuesta :

priyenas1 priyenas1

22-01-2021

Answer:

I think B( art and Sculpture)

Answer Link

Otras preguntas

Study Source A. What does Source A tell you about the Chinese Protectorate? Explain your answer. (b) Study Sources B and C. How similar are these two sources? E

Which of the following is not an island in the East Indies? Group of answer choices O Borneo O Java O Madagascar O Sumatra

if I could please get help with part 1 and 2 -part 3 asks find the thermal energy transferred. Answer in units of kJ

Base the answer for the following questions on hospitality business your chosen business. Explain what budgeting method is used in your chosen business. What ar

A painting by Rembrandt was recently sold for $43 million. Before that, it was sold for $22 million 15 years ago, and for $5 million 34 years ago. What was the

Codons Which amino acids does this mRNA strand code for? *You must spell out the entire name of the amino acid* 5'CCGGAUGUCCGUAUAACGGC3'

Que dijeron tus amigos que harían en las vacaciones?

TP contains 3 Phosphate functional groups. What is a characteristic of the Phosphate group?A) The phosphorus is bound to 4 oxygen atoms, two of these oxygens ar

Select the correct answer. Which element of writing is best suited for an informal tone and an inexperienced audience? OA. slang OB. technical terms OC. long se

A marine biologist was interested in seeing the relationship of a baby manatee's weight and age. She gathered data and wanted to construct a graph to display th