johnsonnaquilla582 johnsonnaquilla582

22-03-2021
Biology

contestada

what pair of nitrogenous bases will form a bond in a DNA molecule

Respuesta :

landrolold landrolold

22-03-2021

Answer:

thymine and adenine

Explanation:

Answer Link

Otras preguntas

How does buck demonstrate to his master his intelligence and his ability? call of the wild?

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

The levels of carbon dioxide are at the highest that they have ever been in history of the earths True or False?????

the right to vote and practice in ones goverment is a right

A(n) ______________ is susceptible to legal attack because some questions may infringe on non-job-related matters such as privacy, diversity, or disability. mul

How did some Southern states respond to the Brown v. Board decision? Question 13 options: school systems refused to honor the ruling and continued to operate s

Which expression is equivalent to 3√27x^18A:3x^3B:3x^6C:9x^3D:9x^6

jessica is hiking in the mountains with her llama, her dog and her cat she comes to river where she must help each animal across one at a time she has a problem

What strategies did both césar chávez and the ufwoc use to achieve their goals? how did they successfully apply these tactics?

henry buys 11 pounds of cherries to make 5 pies. he divides the cherries evenly among the pies. how many pounds of cherries does he use for each pie?