Angery017 Angery017

22-03-2021
English

contestada

Answer this and tell me why you believe it’s the answer

Answer this and tell me why you believe its the answer class=

Respuesta :

autumnklinge0 autumnklinge0

22-03-2021

Answer:

C

Explanation:

if your an athlete walking up a hill should be the least of your problems, especially if your in the Olympics, there is only worse to come.

Answer Link

Otras preguntas

Goverment purchases $15Consumption 90Gross investmen 20Consumption of fixed capital 5Exports 8Imports 12Refer to the accompanying data (all figures in billions

4. PCR Primer design (4 points) You have a piece of DNA that includes the sequence: 5'GATGAGGATGAGGAGAAGTACCGGCCGCCGCCTGCGCATCACAATATGTTCAGT 3' To amplify this

Is a multiplexer a functionally complete device? 1) True 2) False

In many cases the patron will leave without causing a fuss. However in this scenario the patron is refusing to comply and leave when asked.Demonstrate asking a

The miscellaneous type vehicle endorsement to the Personal Auto Policy (PAP) provides coverage for two-wheeled vehicles by ______.

Pinh d Give hab reasens and pink pigments to explain the diffrents position green

When you're verifying design plans for a presentation, use visuals to support and clarify what you have to say, not be the focus of your message. a.Trueb.False

Does someone who has a valid b1/b2 visa from india need to have a welcome letter or email to visit usa?a. Yes b. No

Melodium (MI) is a group 3 element. Paulide (Pi) is a group 7 element. When these two form a compound, what is the chemical formula? MI2Pi MI3PI7 MIPi3 MIPi

Consider these statements: (1) Depression and obesity are related; (2) Depression predicts obesity five 10. A researcher defines delayed ejaculation as occurrin