studentinquiry studentinquiry

23-03-2021
Biology

contestada

2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’.

template DNA 3’ CCTACGGTTCGTACCCCGTATGTGTAACTTGTCAT 5’

Respuesta :

23-03-2021

Answer:

DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’.

Explanation:

Answer Link

Otras preguntas

How do u guys feel about communication changing over the years???

Assuming that Intel needs to borrow money in the bond market to build a new chip-making factory, an increase in interest rates affects Intel's decision about wh

What happens when you reflect a shape over the x-axis and then the y-axis. What is the one transformation that could have been performed to achieve the same res

Is it better for bondholders when the yield to maturity increases or decreases? Bondholders are better off when the yield to maturity: A. decreases, since th

Which of the major continental regions of the United States is best for farming?

A 1210 W radiant heater is constructed to operate at 115 V. (a) What is the current in the heater when the unit is operating? (b) What is the resistance of the

You have a secret that you tell to one person. Every hour, each of the people that know the secret tells one person. The number of people who know is N, and t i

All of the following statements regarding uncertainty in liabilities are true except: A. Liabilities can involve uncertainty in whom to pay.B. A company can cre

Inés desea que sus hijos siempre (estar) sanos. Question 2 with 1 blank Mi madre insiste en que (yo) (ir) al médico. Question 3 with 1 blank La enfermera ru

A mixture of 50 liters of paint is 25% red tint, 30% yellow tint and 45% water. 7 liters of yellow tint is added to the original mixture. What percent of yellow