nas2445 nas2445

23-05-2021
Mathematics

contestada

Yasmeen is setting up a business.
She borrows $5000 from a loan company.
The loan company charges 6% per year simple interest.
How much interest will Yasmeen pay after 3 years?

Respuesta :

23-05-2021

5000 x 6% =300
300 x 3 = $900

Answer Link

Otras preguntas

john bought a used truck for $4,500 he made an agreement with the dealer to put $1,500 down and mae payments of $350 for the next 10 months the extra cost paid

6 is 12% of what number

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Chloe’s mother wants to have another child. However, she is concerned that a second child might also have CF, so she encourages Chloe’s stepfather to be tested.

. If a human has not eaten in 6 days,

Identify your human rights violation and explain in a introductory paragraph why you choose the specific human rights

A cylindrical can of cat food has a diameter of 3.5 inches and a height of 1.25 inches A second brand of cat food is packaged in a cylindrical can with a radius

Is sextillion a real number?

If 60 is 75% of a value, what is that value?

The Glorious Revolution of 1688 demonstrated that Parliament had