tusigaasiata2021 tusigaasiata2021

23-08-2021
Biology

contestada

what pigment does animal such as insects have

Respuesta :

prashna04karki prashna04karki

23-08-2021

Answer:

Animal such as insecta have porphyrin pigment.

Hope it is helpful....

Answer Link

Otras preguntas

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

Bjr, svp quelqu’un peut m’aider a resoudre cette exercice car je ne sais pas comment, merci bcp Svp c’est pour demain

The longer Abu-Lughod stayed in the Bedouin community, the more she was seen as a daughter of the family. What were the expectations of her as an adopted daught

why would we use m^3 instead of cm^3 to describe the volume of a room?

NEED HELP ON THIS URGENTLY PLEASE? Three reasons why your Henry Hudson should be Governor of the Fictitious Exploration State.

HELP ME OUT IS DUE TODAY!

Explain two events: (1) placing a hot pack on your skin and making your skin feel warmer, and (2) placing a cold pack on your skin and making your skin feel col

The circles in the diagrams below represent energy levels in an atom, and the arrows show electron (blue dot) transitions from one energy level to another. (The

It takes Sophia 4/5 hour to walk to the store 2/3 mile away. What is her walking pace in miles per hour?

30-2⁴+4(8-5)/6 (answers with steps pls-)