queenisicy46 queenisicy46

25-10-2021
Mathematics

contestada

need help!!!

which addition matches the problem...

need help which addition matches the problem class=

Respuesta :

Dragonlov46er Dragonlov46er

25-10-2021

Answer:

The addition that matches the problem is the first one.

Step-by-step explanation:

The red line goes back 8 so it is a -8 and the blue line goes forward 4 so it is a postive 4.

4 + (-8) = -4

Answer Link

Otras preguntas

Codons Which amino acids does this mRNA strand code for? *You must spell out the entire name of the amino acid* 5'CCGGAUGUCCGUAUAACGGC3'

Question 1 of 10 Which of the following is the first step for engaging in scientific inquiry? A. Conduct an investigation. B. Collect and evaluate data. C. Form

30 20 90 CLAY (%) 40. 50 60 Sandy 88 ㅎ8 80 90 80 100 10 70 Clay 20 30 40 50 Silty Clay SILT (%) 60 Clay Clay Loam Silty Clay Sandy Clay Loam Loam 70 20 80 Loam

what is the average speed of 120m and 8.5 seconds

Create a Python program that solves the attached Probability (Uses Poisson Distribution) question. Please provide the code and the result.

(1) Sandra Cisneros's "Mericans" is about a young American girl of Mexican descent who is struggling between her cultural heritage and American identity. (2) Ci

CyberTech's board served as an external audience during the negotiations. 1.True 2.False

From the corporate social responsibility point of view, a focus on regulatory compliance with little involvement by top management is what type of strategy? 1)

In a canyon between two mountains, a spherical boulder with a radius of 1.4 m is just set in motion by a force of 230 N. The force is applied at an angle of 73.

The total amount of rain that fell in the city during the month of August was 8 1/4 inches. What was the difference in total rainfall in inches between August a