35jazzmin2027 35jazzmin2027

26-01-2022
English

contestada

1. Identify the causes and effects of the revolution.

2. What makes the Haitian Revolution different from any other revolution in history?

3. How did the America and French Revolutions influence the Haitian Revolution?

Respuesta :

naitikgursani naitikgursani

01-06-2022

Answer:

The effects of revolution is that there are many changes and there is a lot of war

Answer Link

Otras preguntas

Sarah's class recycled 3. 7 7/9 boxes of paper in a month. If they recycled another 9 2/8 boxes the next month what wasvthe total amount recycled

Mrs. Bell's class is selling Hobbs Middle Jaguar t-shirts to raise money for a trip. They typically sell 400 t-shirts a year for $10 per shirt. Mrs bell knows t

Explain lt Explain why the formula for finding the surface area of a rectangular prism is helpful. I NEED HELP !

Sarabeth ran 1 2/5 miles on a path around the park. This was 5/8 of the distance around the park. What is the distance around the park.

how was sam houston passionate? give atleast 2 examples with explanation

The number of cells in an average-sized adult human is on the order of 10^14 cells. Use this information, and the estimate that the length of DNA contained in e

Which of the following statements about tuberculosis is FALSE? A.It usually affects the digestive tract. B. It responds to a long course of antibiotic treatment

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

What educational level, age and econimic status of the audience do I reach when talking bout geriatric offices

what is 7/8ths of 40