contestada

DNA Mutation Simulation Access the simulation at: https:/www.biologycorner.com/worksheets/DNA-sim.html 1) Transcribe and Translate your original DNA. Review those terms and write a short definition Transcription: Translation: 2) Identify the major players shown in the simulation: MRNA, Codon, Amino Acid, tRNA, anticodon, ribosome. Use the figure below to label these parts. U с G 3. When the protein is completed, write the sequence of amino acids shown, there are 11. (Hint: click the "stop" button to make the model stop jiggling.) 4. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG 5. Edit the DNA by changing all of the first triplet to AAA Check the new protein created by your new DNA. Describe how this changed the protein. ashialancone.com 6. Return the triplet to its original state (ATG). Now place an additional A after the G. your strand will read ATGA. Check the new protein created by your new DNA. Describe how this changed the protein. 7. Return the triplet to its original state (ATG). Now change the second triplet from CCA to CCC Check the new protein created by your new DNA. Describe how this changed the protein. Final Analysis - Reply... Cmanthi a y You can see you opmd he he's lyou a w Oned 8. First, you created a POINT mutation in your DNA. DescrIbe what a point mutation is an how this can alfect the protein created by the gene.

Respuesta :

mickymike92

DNA mutation are can results in synthesis of proteins which differ from the original protein coded for by the non-mutated DNA.

What is DNA Mutation?

DNA mutation refers to changes that occurs in the sequence of nucleotides in a DNA molecule.

Different types of mutation that can occur include:

  • point mutation- where a single nucleotide is changed.
  • deletions - where a nucleotide is deleted
  • insertions - where a nucleotide is inserted

Because DNA molecules are used in making proteins, mutation that occurs in DNA can affect the protein synthesized from the DNA.

First, DNA is converted to RNA in a process known as transcription.

An mRNA molecule is produced which is then used to synthesize proteins at the ribosomes on a process known as translation.

The mRNA molecule is read in triplets known as codons.

tRNA molecules brings the required amino acids that each codons represents and the amino acid sequence is used to make proteins.

Learn more about mutations at: https://brainly.com/question/17031191

Otras preguntas