spectregolden71 spectregolden71

25-03-2022
Mathematics

contestada

what would be twice a number?

Respuesta :

SkiQueen SkiQueen

25-03-2022

Answer:

2x

Step-by-step explanation:

Substitute the x for a number like 2 and you multiply the 2 numbers together to get the total and in this case it would be 4.

Have a great day!!

Please rate and mark brainliest!!

Answer Link

Otras preguntas

Can i get some help :

write a short paragraph (three to four sentences) that explains how it works for computers and internet communications in relation to cybersecurity.

if f(x) = 2x^2 +1 and g(x) = 3x-2 what is the value of f(g(x))

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

The following ordered pairs represent a function. (-2,-4) (-1, -2) (0, 0) (1, 2) (2, 4) Which two ordered pairs can be added to the given set and still have the

Plz help me with this

All of the following are functions of the nervous system except.

What is the value of x?

Which number sentence is not true? 101 < 100 101 = 0 |-100[< 101 1-100] > [0]

A truck is moving with the velocity of 72 km/h. When the driver applies , the truck comes to rest in 2 seconds. Calculate the and distance covered by the truck