ariannaobregon ariannaobregon

26-01-2015
Mathematics

contestada

what is 9/16 closer to 0, 1, or 1/2?

Respuesta :

hfelltennis hfelltennis

26-01-2015

Sense we are dealing with 16 we must put each number over sixteen. 0= 0/16
1 = 16/16 and 1/2 = 8/16. 8/16 is only 1/16 away from 9/16, therefore our answer is 1/2

Answer Link

Otras preguntas

What is the most common cause of liver failure ?

how did Thomas Edison contribute to the Industrial Revolution

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

can I get the answers for number 14 plz?

14. Which of Canada's Atlantic Provinces has jurisdiction over mainly uninhabited Labrador?

The majority of people that Muhammad came into contact with were A:Monotheistic B:Polytheistic C:A mixture of both

what is the property of 6x=72

Why are they called SH2 domains?

Explain which one of the above market control measures is applicable in the Labour market and justify why it is important to consider the effects of such action

Discussion the following: Compare and contrast 1. a. Niacin b. Folate c. B12 deficiency d. Riboflavin Thank you