jcorey6858 jcorey6858

26-04-2022
Chemistry

contestada

. Why is it important to know the conditions under which an aqueous redox reaction takes place in order to balance the ionic equation for the reaction

Respuesta :

adorablearman14 adorablearman14

03-05-2022

Answer:

Just like with any other reaction, balancing the equation for the reaction is important so that people can know all the inputs and outputs, and know how much of each input (reactant) is needed to produce a certain amount of product.

Answer Link

Otras preguntas

what number must you add to the polynomial below to complete the square? x^2-x A. 1/4 B. 1/2 C. 2 D. 1

If a DNA template strand has a sequence of 3' TACAATGTAGCC 5', then the RNA produced from it will be which sequence? A.) 3' AUGUUACAUCGG 5'. B.) 3' TACAATGTAGCC

which of the following expressions is equal to 1? a. 5^0 x 6^-3 x 6^3 x 5^1 b. 5^2 x 6^-2 x 6^3 x 5^-3 c. 5^2 x 5^-2 x 6^0 x 6^2 d. 5^-1 x 6^5 x 6^-5 x 5

Frank uses improper body position to lift a heavy box and strains the muscles in his lumbar region. which muscles are most likely to be involved in this injury?

what are the 3 care instructions for future life on earth

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

what feature of a confederal system did the confederate states of america most want

if you are given a 2% raise and inflation rate is 3% you are

Perpendicular lines intersect to form __________________ angles

A number triple and tripped again is 729 what is the number show workings