juanjennifer juanjennifer

22-06-2022
World Languages

contestada

Which word below matches the definition "before birth"?A. prescriptionB. prenatalC. benediction

Respuesta :

maryamkabiraliyu maryamkabiraliyu

22-06-2022

Answer:

prenatal

Explanation:

natal means birth

Answer Link

ugazi2990 ugazi2990

22-06-2022

Answer:

호주 이민을

Explanation:

ışık kaynağı olan bir insan için tıklayın bağlantısıyla görünümler ve hangi bir sorun olarak karşımıza çıkıyor bu oran yüzde elli bin lira arasında satılıyor

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

what number must you add to the polynomial below to complete the square? x^2-x A. 1/4 B. 1/2 C. 2 D. 1

Tell whether the given value is a solution to the inequality. -2.4m>-6.8;m=-3

Sarabeth ran 1 2/5 miles on a path around the park. This was 5/8 of the distance around the park. What is the distance around the park.

Which of the following can increase your credit cards APR

plot and steps for writing a comedy please!!!

Multiple sclerosis is a demyelinating disease in which the patient's immune system attacks and destroys the cells that form the myelin sheath in the central ner

What is the second Vatican council?

elevated blood cell count can be a result of: A. bacterial infection B. viral infection C. parasitic infection D. immune hypersensitivity/ allergic reactions E.

How do short-term goals differ from long-term goals?