ggtonytube ggtonytube

23-03-2017
History

contestada

Why would Andrew Carnegie and Friedrich Engels disagree about the effects of industrialization

Respuesta :

tennisrocks99 tennisrocks99

23-03-2017

Andrew Carnegie never experienced hard working conditions first hand, but Friedrich Engels spends his time working in the slums.They have experience different things in their work, so their views are bound to be different.

Answer Link

Otras preguntas

.Given mRNA sequences, provide the amino acid sequences, using the three-letter designations, for which they code. A link to a table of codons can be found here

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

if if x+y=10, find the value of y when x=3

a solution of 0.10 hydrochloric acid, HCL is a better conductor of electricity than 0.10 M acetic acid, CH3COOH. sketch the ions and molecules in both solutions

how are the four earths systems connected

The chorionic villi of the placenta develop a series of capillaries that are immersed in lacunae of the mother's blood for exchange into the embryo's blood duri

87.5 of what number is 315

Explain which one of the above market control measures is applicable in the Labour market and justify why it is important to consider the effects of such action

Translate these lines from the poem. "Bot wold ye, lady louely, then leue me grante Nay, for sothe, beau sir, sayd that swete" WOW, I'M LOST!! #ihatemyenglishc

Prolonged use of antipsychotics may lead to ______ in adults..... extrapyramidal effects and tardive dyskinesia parkinsonism-like symptoms neither a or b both a