blakelloyd blakelloyd

21-06-2017
Chemistry

contestada

if a scale on earth reads 650 N what is your mass?

Respuesta :

evelyng17eg evelyng17eg

23-06-2017

Weight = (mass) x (gravity)

Acceleration of gravity on Earth = 9.8 m/s²

Weight on Earth = (mass) x (9.8 m/s²)

Divide each side by (9.8 m/s²): Mass = (weight) / (9.8 m/s²)

Mass = (650 N) / (9.8 m/s² Mass = 66.33 kg (rounded)

Answer Link

Otras preguntas

write the complete thermochemical equation (including energy) for the combustion of hexane.

approximately how long does it take the moon to complete one orbit around earth

1.true or false A phrase is a word group with a subject or a verb but not both. 2.true or false A clause is a word group that has both a subject and a verb a

---------- is the ability to do an activity for more than a few minutes. What is the blank?

Which best describes the climax of the Odyssey? A. Odysseus kisses the ground as his journey home comes to an end. B. Odysseus sees Telemachus for the fir

Compared to mitosis, meiosis results in greater... A)amount of cell cytoplasm per cell B)number of daughter cells per cell C)amount of genetic material per cell

What name was given to the Allied plan to invade France?

The role of media on reporting human rights violation

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

9. There are many more organisms that use double stranded DNA to carry their genetic information than there are organisms that use single stranded DNA to carry