rallen7161 rallen7161

21-11-2017
Biology

contestada

Which is the correct breakdown of the medical term blepharo pyorrhea into its component parts?

Respuesta :

30-11-2017

blepharo - eyelid; conjunctiv - conjunctiva pyorrhea, is a set of inflammatory diseases affecting the tissues surrounding the teeth.

Answer Link

Otras preguntas

how many atoms are present in 4.0 mol of sodium

tips para perder el miedo a un sismo o terremoto y planes de evacuacion como el triangulo de la vida y kits de emergencia

The election of 1800 demonstrated that the Alien and Sedition Acts were constitutional. the electoral college worked smoothly. the US government was stable. pre

what is the credit card balance? A-The amount of interest you must pay the credit card company. B-The required minimum payment to your credit card company. C-A

1+4=5 2+5=12 3+6=21 8+11=

14. Which of Canada's Atlantic Provinces has jurisdiction over mainly uninhabited Labrador?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

This is Super Confusing to me

1.Why is the coding sequence (whether DNA or RNA) at least three times as long as the protein sequence it codes for? 2.How can the DNA sequence be so different

A single stranded DNA has a base sequence of 5'GACTCCGTAACGGTTAACC3'.What DNA sequence will base pair