Mikey1997 Mikey1997

26-01-2016
Mathematics

contestada

The 7 digit numbers 74A52B1 and 326AB4C are each multiples of 3. Which of the following could be the value of C?

a) 1
b) 2
c) 3
d) 5
e) 8

Respuesta :

Аноним Аноним

26-01-2016

the answer is c I know because I had that problem two

Answer Link

Otras preguntas

Assuming the average composition of air weighs approximately 0.0807 lbs per cubic foot, what is the weight of air in a giant spherical balloon with a diameter o

Which prefix means 1/10 of a unit in the metric system

If the unit selling price is 2.50 and the unit cost is 1.00, what action is needed to maintain the gross margin percentage when unit cost increases 0.25?

PLEASSE HELP ME WITH THIS

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

a solution of 0.10 hydrochloric acid, HCL is a better conductor of electricity than 0.10 M acetic acid, CH3COOH. sketch the ions and molecules in both solutions

8 1/4 in simplest form

write a sentence using the words limiting factor and carrying capacity

the volume of a sphere is 950 cubic inches. Use the formula for the volume of a sphere to find the radius to the nearest tenth of an inch

Dr potter provides vaccinations against polio and measles. Each polio vaccination multi-dose vial consists of 44 individual doses, and each measles vaccination