croitru7857 croitru7857

25-02-2018
Biology

contestada

The base sequence of the template strand of dna is cattggtaggcaaaagaact. what is the new synthesized complementary strand?

Respuesta :

Eric0422 Eric0422

25-02-2018

gtaaccatccgttttcttga

Answer Link

Otras preguntas

Which value is in the domain of f(x)? f(x) = 2x + 5, -6 - 2x + 3, 0<4 o -7 -6 4. 5

which of the following is not a polynomial (a)x^2+ root2*x -3 (b)x^2+ root2x+6 (c)x^3+3x^2-3 (d)6x+4 Pls ans it fast....!!!!!

How might a person’s lifestyle (career, financial situation, family members) impact their diet and nutrition? Please explain and give some examples.

Imagine that your class has decided to stage a folk dance show titled, ‘Colours of life’ in the school auditorium. Make a poster for this event. Put in all the

A study of 40 white mice showed that their average weight was 3.20 ounces. The standard deviation of the population is 0.8 ounces. Which of the following is the

A collection of dimes and nickels has a total value of two dollars and contains 31 coins. How many dimes are there in the collection?

Find the equation of a line passing through the point (2,-4) that is parallel to the line

Find two consecutive even integers whose sum is -50. Which of the following equations could be used to solve the problem? A) 2 x + 2 = -50 B) 2 x = -50 C) 2 x +

Which of the following statements is FALSE? a. The U.S. declared war on Mexico on May 13, 1846. b. Mexico declared a defensive war against the U.S. on April 23,

Approximately how many liters are in 18 quarts?